About   Help   FAQ
Ly6dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ly6dem1(IMPC)J
Name: lymphocyte antigen 6 family member D; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6361282
Gene: Ly6d  Location: Chr15:74633905-74635416 bp, - strand  Genetic Position: Chr15, 34.27 cM
Alliance: Ly6dem1(IMPC)J page
IMPC: Ly6d gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGAGCCATAACAGTGAGC and CTCACCAGGTTCCCATTCAG, which resulted in a 202 bp deletion beginning at Chromosome 15 position 74,762,378 bp and ending after 74,762,579 bp (GRCm38/mm10). This mutation deletes 202 bp from ENSMUSE00000394284 (exon 3) and is predicted to cause a change of amino acid sequence after residue 54 and termination 87 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ly6d Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory