About   Help   FAQ
H2-Eb2b-em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: H2-Eb2b-em1(IMPC)J
Name: histocompatibility 2, class II antigen E beta2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6361196
Synonyms: H2-Eb2em1(IMPC)J
Gene: H2-Eb2  Location: Chr17:34544639-34560386 bp, + strand  Genetic Position: Chr17, 17.98 cM
Alliance: H2-Eb2b-em1(IMPC)J page
IMPC: H2-Eb2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTTTTCTGGAGCAGTTGA and CAGAAATAACTATGACCTTG, which resulted in a 218 bp deletion beginning at Chromosome 17 position 34,333,301 bp and ending after 34,333,518 bp (GRCm38/mm10). This mutation deletes 218 bp of ENSMUSE00000411205 (exon 2) and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any H2-Eb2 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory