About   Help   FAQ
Zfp74em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp74em1(IMPC)J
Name: zinc finger protein 74; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6361131
Gene: Zfp74  Location: Chr7:29632086-29653579 bp, - strand  Genetic Position: Chr7, 17.26 cM
Alliance: Zfp74em1(IMPC)J page
IMPC: Zfp74 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCCAGCCAGGTAAAGCGAG and AGGCAAGGCTGAAGTCTCCC, which resulted in a 921 bp deletion beginning at Chromosome 7 position 29,937,419 bp and ending after 29,938,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000965636 and ENSMUSE00000635760 (exons 3 and 4) and 698 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp74 Mutation:  101 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory