Zfp74em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zfp74em1(IMPC)J |
| Name: |
zinc finger protein 74; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6361131 |
| Gene: |
Zfp74 Location: Chr7:29632086-29653579 bp, - strand Genetic Position: Chr7, 17.26 cM
|
| Alliance: |
Zfp74em1(IMPC)J page
|
| IMPC: |
Zfp74 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCCAGCCAGGTAAAGCGAG and AGGCAAGGCTGAAGTCTCCC, which resulted in a 921 bp deletion beginning at Chromosome 7 position 29,937,419 bp and ending after 29,938,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000965636 and ENSMUSE00000635760 (exons 3 and 4) and 698 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 19 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|