About   Help   FAQ
Zdbf2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zdbf2em1(IMPC)J
Name: zinc finger, DBF-type containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6361129
Gene: Zdbf2  Location: Chr1:63312424-63353735 bp, + strand  Genetic Position: Chr1, 32.31 cM, cytoband C2
Alliance: Zdbf2em1(IMPC)J page
IMPC: Zdbf2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCATATAGCAAAAAGCCTGG and AATGTTAATATCTCTGTCAG, which resulted in a 405 bp deletion beginning at Chromosome 1 position 63,294,676 bp and ending after 63,295,080 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000154511 (exon 6) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zdbf2 Mutation:  102 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory