About   Help   FAQ
Cdc37em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdc37em1(IMPC)J
Name: cell division cycle 37; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6361011
Synonyms: Cdc37-
Gene: Cdc37  Location: Chr9:21050727-21061230 bp, - strand  Genetic Position: Chr9, 7.72 cM, cytoband A3
Alliance: Cdc37em1(IMPC)J page
IMPC: Cdc37 gene page
Cdc37em1(IMPC)J/Cdc37em1(IMPC)J mice exhibit embryonic lethality, with no embryos detected at E7.5 and lower number of embryos than expected at E3.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGATGGCAGATGGCCAGG and TCTGGTCCCCTGTGGTAGCA, which resulted in a 2,555 bp deletion beginning at Chromosome 9 position 21,140,717 bp and ending after 21,143,271 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000217364 through ENSMUSE00000217367 (exons 2-7) and 1673 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 due to the deletion of 295 amino acids but remains in frame for the last 50 amino acids. There is an additional 1bp (A) deletion 3 bp upstream of the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cdc37 Mutation:  38 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory