Cdc37^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdc37^em1(IMPC)J
• Name: cell division cycle 37; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6361011
• Synonyms: Cdc37^-
• Gene: Cdc37 Location: Chr9:21050727-21061230 bp, - strand Genetic Position: Chr9, 7.72 cM, cytoband A3
• Alliance: Cdc37^em1(IMPC)J page
• IMPC: Cdc37 gene page

Cdc37^em1(IMPC)J/Cdc37^em1(IMPC)J mice exhibit embryonic lethality, with no embryos detected at E7.5 and lower number of embryos than expected at E3.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GCAGATGGCAGATGGCCAGG and TCTGGTCCCCTGTGGTAGCA that targeted exon(s) ENSMUSE00000217364.6 ENSMUSE00000217367.4 ENSMUSE00000217368.4 ENSMUSE00000217369.4 ENSMUSE00000217371.4 ENSMUSE00000441347.4 ENSMUSE00001888169.1 ENSMUSE00001888170.1 ENSMUSE00001888173.1 ENSMUSE00001888175.1 ENSMUSE00001888181.1 ENSMUSE00001888183.1 ENSMUSE00001888187.1 ENSMUSE00001888201.1. This resulted in deletion(s) of 2555 bp (location: Chr9:21052013-21054567; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdc37 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)