About   Help   FAQ
Pcdh11xem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcdh11xem1(IMPC)J
Name: protocadherin 11 X-linked; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6360686
Gene: Pcdh11x  Location: ChrX:119199956-119820316 bp, + strand  Genetic Position: ChrX, 49.58 cM
Alliance: Pcdh11xem1(IMPC)J page
IMPC: Pcdh11x gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCCAACTGATTGTTCAAA and GGTCTGATATGCACAGACAC, which resulted in a 2408 bp deletion beginning at Chromosome X position 120,399,472 bp and ending after 120,401,879 bp (GRCm38/mm10). This mutation deletes 2408 bp from ENSMUSE00000435881 (exon 3) and is predicted to cause a change of amino acid sequence after residue 203 and early truncation 51 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pcdh11x Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory