Pcdh11x^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdh11x^em1(IMPC)J
• Name: protocadherin 11 X-linked; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6360686
• Gene: Pcdh11x Location: ChrX:119199956-119820316 bp, + strand Genetic Position: ChrX, 49.58 cM
• Alliance: Pcdh11x^em1(IMPC)J page
• IMPC: Pcdh11x gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCCAACTGATTGTTCAAA and GGTCTGATATGCACAGACAC, which resulted in a 2408 bp deletion beginning at Chromosome X position 120,399,472 bp and ending after 120,401,879 bp (GRCm38/mm10). This mutation deletes 2408 bp from ENSMUSE00000435881 (exon 3) and is predicted to cause a change of amino acid sequence after residue 203 and early truncation 51 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pcdh11x Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)