Nap1l3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nap1l3^em1(IMPC)J
• Name: nucleosome assembly protein 1-like 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6360667
• Gene: Nap1l3 Location: ChrX:121304257-121307082 bp, - strand Genetic Position: ChrX, 49.81 cM
• Alliance: Nap1l3^em1(IMPC)J page
• IMPC: Nap1l3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCTGAAGTCATGGTAGT and TCACAGAACCTGGTGCCCAT, which resulted in a 1549 bp deletion beginning at Chromosome X position 122,395,429 bp and ending after 122,396,977 bp (GRCm38/mm10). This mutation deletes 1549 bp of ENSMUSE00000471845 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nap1l3 Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)