Slc16a11em1Smoc
Endonuclease-mediated Allele Detail
|
Symbol: |
Slc16a11em1Smoc |
Name: |
solute carrier family 16 (monocarboxylic acid transporters), member 11; endonuclease-mediated mutation 1, Shanghai Model Organisms Center |
MGI ID: |
MGI:6358784 |
Gene: |
Slc16a11 Location: Chr11:70104717-70107239 bp, + strand Genetic Position: Chr11, 42.99 cM
|
Alliance: |
Slc16a11em1Smoc page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: CRISPR/Cas9 technology targeted the first exon (guide RNA sequences: GCCGCAGCATTCGCCGTGAA+CGG) and generated a 38 bp deletion (CGTAGGAGAGCCCGTTCACGGCGAATGCTGCGGCCGCC) resulting in a frame shift that is expected to produce a truncated protein with 33 amino acids. Expression of the mRNA is only about 10% of that of wild-type and Western blot analysis confirmed absence of protein in livers due to nonsense-mediated decay of mRNA.
(J:278098)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Slc16a11 Mutation: |
17 strains or lines available
|
|
Original: |
J:278098 Zhao Y, et al., Gain-of-Function Mutations of SLC16A11 Contribute to the Pathogenesis of Type 2 Diabetes. Cell Rep. 2019 Jan 22;26(4):884-892.e4 |
All: |
1 reference(s) |
|