About   Help   FAQ
Slc16a11em1Smoc
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc16a11em1Smoc
Name: solute carrier family 16 (monocarboxylic acid transporters), member 11; endonuclease-mediated mutation 1, Shanghai Model Organisms Center
MGI ID: MGI:6358784
Gene: Slc16a11  Location: Chr11:70104717-70107239 bp, + strand  Genetic Position: Chr11, 42.99 cM
Alliance: Slc16a11em1Smoc page
Mutation
origin
Strain of Origin:  C57BL/6JSmoc
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology targeted the first exon (guide RNA sequences: GCCGCAGCATTCGCCGTGAA+CGG) and generated a 38 bp deletion (CGTAGGAGAGCCCGTTCACGGCGAATGCTGCGGCCGCC) resulting in a frame shift that is expected to produce a truncated protein with 33 amino acids. Expression of the mRNA is only about 10% of that of wild-type and Western blot analysis confirmed absence of protein in livers due to nonsense-mediated decay of mRNA. (J:278098)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Slc16a11 Mutation:  17 strains or lines available
References
Original:  J:278098 Zhao Y, et al., Gain-of-Function Mutations of SLC16A11 Contribute to the Pathogenesis of Type 2 Diabetes. Cell Rep. 2019 Jan 22;26(4):884-892.e4
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory