Scn9a^em1Jnsn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scn9a^em1Jnsn
• Name: sodium channel, voltage-gated, type IX, alpha; endonuclease-mediated mutation 1, James Johnson
• MGI ID: MGI:6358177
• Synonyms: Scn9a-flox
• Gene: Scn9a Location: Chr2:66310424-66465306 bp, - strand Genetic Position: Chr2, 39.13 cM
• Alliance: Scn9a^em1Jnsn page

Mutation origin

• Strain of Origin: NOD/ShiLtJ

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 endonuclease-mediated genome editing is used to insert loxP sites flanking exon 3. A single guide RNA with a spacer sequence and Cas9 endonuclease mRNA were introduced into NOD/ShiLtJ-derived fertilized eggs by pronuclear injection along with a single-strand oligonucleotide repair template with the loxP sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Scn9a Mutation: 124 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)