About   Help   FAQ
Etv2em1Djg
Endonuclease-mediated Allele Detail
Summary
Symbol: Etv2em1Djg
Name: ets variant 2; endonuclease-mediated mutation 1, Daniel J Garry
MGI ID: MGI:6358103
Synonyms: Etv2 Mut
Gene: Etv2  Location: Chr7:30333041-30335277 bp, - strand  Genetic Position: Chr7, 18.92 cM, cytoband A3
Alliance: Etv2em1Djg page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe 3.9-kb promoter upstream of Etv2 was deleted using gRNAs (targeting AATGCAAGCTTACCCCCAGC and GCCAGAGGTGAGCCACGAAC) with CRISPR/Cas9 technology. (J:276308)
Expression
In Mice Carrying this Mutation: 5 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Etv2 Mutation:  11 strains or lines available
References
Original:  J:276308 Koyano-Nakagawa N, et al., Feedback Mechanisms Regulate Ets Variant 2 (Etv2) Gene Expression and Hematoendothelial Lineages. J Biol Chem. 2015 Nov 20;290(47):28107-19
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory