Tktl2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tktl2em1(IMPC)J |
| Name: |
transketolase-like 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6357997 |
| Gene: |
Tktl2 Location: Chr8:66964408-66970987 bp, + strand Genetic Position: Chr8, 33.14 cM, cytoband B3.3
|
| Alliance: |
Tktl2em1(IMPC)J page
|
| IMPC: |
Tktl2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGCGCAGACTTTCCTCAA and TGATTGCAAAGTTTTATGAT, which resulted in a 2265 bp deletion beginning at Chromosome 8 position 66,511,711 bp and ending after 66,513,975 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000151364 (exon 1) and 244 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|