About   Help   FAQ
Clec3aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Clec3aem1(IMPC)J
Name: C-type lectin domain family 3, member a; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6357989
Gene: Clec3a  Location: Chr8:115144826-115152586 bp, + strand  Genetic Position: Chr8, 60.96 cM
Alliance: Clec3aem1(IMPC)J page
IMPC: Clec3a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCTCCTAATCCCTTTGGG and GTAGGCCCCCTCAGTAAACT, which resulted in a 730 bp deletion beginning at Chromosome 8 position 114,425,191 bp and ending after 114,425,920 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365573 (exon 3) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 23 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Clec3a Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory