Zfp697em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zfp697em1(IMPC)J |
Name: |
zinc finger protein 697; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6357937 |
Gene: |
Zfp697 Location: Chr3:98289278-98508893 bp, + strand Genetic Position: Chr3, 42.75 cM
|
Alliance: |
Zfp697em1(IMPC)J page
|
IMPC: |
Zfp697 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAAAGGGCTATCCTCCGTG and CAGAAGTTGCACTTGTGTTA, which resulted in a 1360 bp deletion beginning at Chromosome 3 position 98,427,181 bp and ending after 98,428,540 bp (GRCm38/mm10). This mutation deletes 1360 bp from ENSMUSE00000467437 (exon 3) and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 44 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|