About   Help   FAQ
Rnf217em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf217em1(IMPC)J
Name: ring finger protein 217; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6357892
Gene: Rnf217  Location: Chr10:31377883-31485721 bp, - strand  Genetic Position: Chr10, 17.45 cM
Alliance: Rnf217em1(IMPC)J page
IMPC: Rnf217 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCAGGGCATATAAGTCAG and GCCATGTTACAGGATCATAA, which resulted in a 2551 bp deletion beginning at Chromosome 10 position 31,503,602 bp and ending after 31,506,152 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463122 and ENSMUSE00000464525 (exons 4 and 5) and 2237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 400 and truncation 55 amino acids later by read through into the 3 UTR. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnf217 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory