Plekhg2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plekhg2^em1(IMPC)J
• Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6356394
• Gene: Plekhg2 Location: Chr7:28059029-28072024 bp, - strand Genetic Position: Chr7, 16.71 cM
• Alliance: Plekhg2^em1(IMPC)J page
• IMPC: Plekhg2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAACGGCTAGAAGTAGGGCA and TCCCATGACAAGACTCCAGA, which resulted in a 1561 bp deletion beginning at Chromosome 7 position 28,367,390 bp and ending after 28,368,950 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001262284 to ENSMUSE00001304994(exons 5-9) and 957 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 156 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Plekhg2 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)