About   Help   FAQ
Noc4lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Noc4lem1(IMPC)J
Name: NOC4 like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6356390
Gene: Noc4l  Location: Chr5:110796285-110801248 bp, - strand  Genetic Position: Chr5, 53.69 cM
Alliance: Noc4lem1(IMPC)J page
IMPC: Noc4l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAAGTACTTTAGAGATGAG and CTATTTAAGATGCCAGACCG, which resulted in a 283 bp deletion beginning at Chromosome 5 position 110,652,269 bp and ending after 110,652,551 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001263903 (exon 3) and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 56 amino acids later. There is a 4 bp deletion (GTGT) 147 bp after the 283 bp deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Noc4l Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory