Noc4l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Noc4l^em1(IMPC)J
• Name: NOC4 like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6356390
• Gene: Noc4l Location: Chr5:110796285-110801248 bp, - strand Genetic Position: Chr5, 53.69 cM
• Alliance: Noc4l^em1(IMPC)J page
• IMPC: Noc4l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAAGTACTTTAGAGATGAG and CTATTTAAGATGCCAGACCG, which resulted in a 283 bp deletion beginning at Chromosome 5 position 110,652,269 bp and ending after 110,652,551 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001263903 (exon 3) and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 56 amino acids later. There is a 4 bp deletion (GTGT) 147 bp after the 283 bp deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Noc4l Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)