About   Help   FAQ
Gal3st3em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Gal3st3em1(IMPC)Bay
Name: galactose-3-O-sulfotransferase 3; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6355939
Gene: Gal3st3  Location: Chr19:5348359-5358766 bp, + strand  Genetic Position: Chr19, 4.29 cM
Alliance: Gal3st3em1(IMPC)Bay page
IMPC: Gal3st3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences CCCATAAGAGCACTGCCCCGTAT, CCCGCCTCTGCGAGAATCGCCAC, which resulted in an intergenic deletion. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gal3st3 Mutation:  27 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory