Ugt1a6bem1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ugt1a6bem1(IMPC)Bay |
| Name: |
UDP glucuronosyltransferase 1 family, polypeptide A6B; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6355938 |
| Gene: |
Ugt1a6b Location: Chr1:88030979-88146720 bp, + strand Genetic Position: Chr1, 44.51 cM
|
| Alliance: |
Ugt1a6bem1(IMPC)Bay page
|
| IMPC: |
Ugt1a6b gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences CCCTCCAATGAAGATCATGT and TGTAGTTCTTCTAGGCTGTA that targeted exon(s) ENSMUSE00000694454.2 ENSMUSE00001018037.2 ENSMUSE00000694447.2 ENSMUSE00001321441.2 ENSMUSE00001332354.2 ENSMUSE00000710155.2 ENSMUSE00000721465.2 ENSMUSE00001577017.1 ENSMUSE00001810895.1 ENSMUSE00002130752.1 ENSMUSE00002160521.1 ENSMUSE00002196327.1. This resulted in deletion(s) of 571 bp (location: Chr1:88034900-88035470; GRCm39), 571 bp (location: Chr1:88066432-88067002; GRCm39), and 30286 bp (location: Chr1:88035888-88066173; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
4 reference(s) |
|