About   Help   FAQ
Zfp687em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp687em1(IMPC)Bay
Name: zinc finger protein 687; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6355936
Gene: Zfp687  Location: Chr3:94913901-94922759 bp, - strand  Genetic Position: Chr3, 40.74 cM, cytoband F2
Alliance: Zfp687em1(IMPC)Bay page
IMPC: Zfp687 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences GCACTGAAGCTGCAGCGATTGGG, GACATGGCGCCTCAGGCTTGGGG, which resulted in an intragenic deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp687 Mutation:  44 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory