Zfp687em1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zfp687em1(IMPC)Bay |
| Name: |
zinc finger protein 687; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6355936 |
| Gene: |
Zfp687 Location: Chr3:94913901-94922759 bp, - strand Genetic Position: Chr3, 40.74 cM, cytoband F2
|
| Alliance: |
Zfp687em1(IMPC)Bay page
|
| IMPC: |
Zfp687 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences GACATGGCGCCTCAGGCTTG and GCACTGAAGCTGCAGCGATT that targeted exon(s) ENSMUSE00001242821.2 ENSMUSE00001256028.2 ENSMUSE00001257969.2 ENSMUSE00001273615.2 ENSMUSE00001312089.2. This resulted in deletion(s) of 1752 bp (location: Chr3:94915749-94917500; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
4 reference(s) |
|