Cnga2^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cnga2^em1(IMPC)H
• Name: cyclic nucleotide gated channel alpha 2; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6355929
• Gene: Cnga2 Location: ChrX:71035455-71053824 bp, + strand Genetic Position: ChrX, 37.15 cM, cytoband A6
• Alliance: Cnga2^em1(IMPC)H page
• IMPC: Cnga2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences TGGATACTCCACGCAGGGGAAGG, CCCACGGAAACGCTCTAGGAAGG, GAGATGGATACTCCACGCAGGGG, CCTTCCTAGAGCGTTTCCGTGGG, which resulted in an intergenic deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cnga2 Mutation: 15 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)