About   Help   FAQ
Rcc1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Rcc1em1(IMPC)Tcp
Name: regulator of chromosome condensation 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6342905
Gene: Rcc1  Location: Chr4:132059230-132073061 bp, - strand  Genetic Position: Chr4, 65.2 cM
Alliance: Rcc1em1(IMPC)Tcp page
IMPC: Rcc1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1319 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes single guide RNAs having spacer sequences of AGCCAGTAAATAATCTCGAA and AGTCTGCGAACTGTGTTGGG and 2 single-strand oligonucleotides to introduce loxP sites. The loxP sites were not incorporated into this allele instead a 815-bp Chr4: 132335167 to 132335981_insGACTCCTG. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rcc1 Mutation:  119 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory