Nsdhlem1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nsdhlem1(IMPC)Bay |
| Name: |
NAD(P) dependent steroid dehydrogenase-like; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6342893 |
| Gene: |
Nsdhl Location: ChrX:71962163-72002120 bp, + strand Genetic Position: ChrX, 37.29 cM
|
| Alliance: |
Nsdhlem1(IMPC)Bay page
|
| IMPC: |
Nsdhl gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele from IMPC was generated at Baylor College of Medicine by injecting CAS9 Protein and 4 guide sequences AGATCAGCTGTCAGCAAAATTGG, AGTTATAGTGTGCTGTCCCAAGG, CCAAATATGTCATAGGTCTGCCT, CCAAGATCAGCTGTCAGCAAAAT, which resulted in a Exon Deletion.
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Nsdhl Mutation: |
11 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
1 reference(s) |
|