About   Help   FAQ
Rfxapem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rfxapem1(IMPC)J
Name: regulatory factor X-associated protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6342848
Gene: Rfxap  Location: Chr3:54710536-54715212 bp, - strand  Genetic Position: Chr3, 25.69 cM, cytoband D
Alliance: Rfxapem1(IMPC)J page
IMPC: Rfxap gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACAGGCAACGTCAAACTGG and GGAGGCGCAGGCTGTGCCCG, which resulted in a 453 bp deletion beginning at Chromosome 3 position 54,807,204 bp and ending after 54,807,656 bp (GRCm38/mm10). This mutation deletes 453 bp of ENSMUSE00000389769 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6, delete 151 amino acids then return into frame for the remaining 74 amino acids and stop codon. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rfxap Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory