About   Help   FAQ
Lrif1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrif1em1(IMPC)J
Name: ligand dependent nuclear receptor interacting factor 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6342842
Gene: Lrif1  Location: Chr3:106592303-106643893 bp, + strand  Genetic Position: Chr3, 46.52 cM
Alliance: Lrif1em1(IMPC)J page
IMPC: Lrif1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TACCAAGTAGTTCCTACGAT and AACAGTTGCTGCATCAACAG, which resulted in a 643 bp deletion beginning at Chromosome 3 position 106,732,447 bp and ending after 106,733,089 bp (GRCm38/mm10). This mutation deletes 643 bp of ENSMUSE00000413972 (exon 2) and is predicted to cause a change of amino acid sequence after residue 282 and early truncation 25 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lrif1 Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory