Lrif1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrif1^em1(IMPC)J
• Name: ligand dependent nuclear receptor interacting factor 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342842
• Gene: Lrif1 Location: Chr3:106592303-106643893 bp, + strand Genetic Position: Chr3, 46.52 cM
• Alliance: Lrif1^em1(IMPC)J page
• IMPC: Lrif1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TACCAAGTAGTTCCTACGAT and AACAGTTGCTGCATCAACAG, which resulted in a 643 bp deletion beginning at Chromosome 3 position 106,732,447 bp and ending after 106,733,089 bp (GRCm38/mm10). This mutation deletes 643 bp of ENSMUSE00000413972 (exon 2) and is predicted to cause a change of amino acid sequence after residue 282 and early truncation 25 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lrif1 Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)