About   Help   FAQ
Pcdhb3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcdhb3em1(IMPC)J
Name: protocadherin beta 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6342799
Gene: Pcdhb3  Location: Chr18:37433852-37437638 bp, + strand  Genetic Position: Chr18, 19.46 cM, cytoband B3
Alliance: Pcdhb3em1(IMPC)J page
IMPC: Pcdhb3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTCTGGGTGGGTCTCTTGC and GGTGATACCAAACCTGTTTC, which resulted in a 2259 bp deletion beginning at Chromosome 18 position 37,301,055 bp and ending after 37,303,313 bp (GRCm38/mm10). This mutation deletes 2259 bp of ENSMUSE00000402031 (exon 1) and is predicted to cause a change of amino acid sequence after residue 25 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pcdhb3 Mutation:  42 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory