Pcdhb3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pcdhb3em1(IMPC)J |
| Name: |
protocadherin beta 3; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6342799 |
| Gene: |
Pcdhb3 Location: Chr18:37433852-37437638 bp, + strand Genetic Position: Chr18, 19.46 cM, cytoband B3
|
| Alliance: |
Pcdhb3em1(IMPC)J page
|
| IMPC: |
Pcdhb3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTCTGGGTGGGTCTCTTGC and GGTGATACCAAACCTGTTTC, which resulted in a 2259 bp deletion beginning at Chromosome 18 position 37,301,055 bp and ending after 37,303,313 bp (GRCm38/mm10). This mutation deletes 2259 bp of ENSMUSE00000402031 (exon 1) and is predicted to cause a change of amino acid sequence after residue 25 and early truncation 6 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|