Tacc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tacc1^em1(IMPC)J
• Name: transforming, acidic coiled-coil containing protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342531
• Gene: Tacc1 Location: Chr8:25644568-25730901 bp, - strand Genetic Position: Chr8, 13.7 cM
• Alliance: Tacc1^em1(IMPC)J page
• IMPC: Tacc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGTACCCAGACATCCACG and ACGCTTGCATGGGAGAGCCG, which resulted in a 255 bp deletion beginning at Chromosome 8 position 25,177,885 bp and ending after 25,178,139 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000637671 (exon 2) and 194 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 4 amino acids later. There is a 3 bp insertion (TTA) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tacc1 Mutation: 48 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)