Grxcr1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Grxcr1^em1(IMPC)J
• Name: glutaredoxin, cysteine rich 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342498
• Gene: Grxcr1 Location: Chr5:68189178-68323741 bp, + strand Genetic Position: Chr5, 36.59 cM
• Alliance: Grxcr1^em1(IMPC)J page
• IMPC: Grxcr1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAGGTGACCATGCTAAGA and CAATTTGACCAAAGTGTTGC, which resulted in a 378 bp deletion beginning at Chromosome 5 position 68,031,909 bp and ending after 68,032,286 bp (GRCm38/mm10). This mutation deletes 378 bp of ENSMUSE00000598905 (exon 1) resulting in a change of amino acid sequence after residue 7, a loss of 126 amino acids and remains in frame. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Grxcr1 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)