About   Help   FAQ
Grxcr1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Grxcr1em1(IMPC)J
Name: glutaredoxin, cysteine rich 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6342498
Gene: Grxcr1  Location: Chr5:68189178-68323741 bp, + strand  Genetic Position: Chr5, 36.59 cM
Alliance: Grxcr1em1(IMPC)J page
IMPC: Grxcr1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAGGTGACCATGCTAAGA and CAATTTGACCAAAGTGTTGC, which resulted in a 378 bp deletion beginning at Chromosome 5 position 68,031,909 bp and ending after 68,032,286 bp (GRCm38/mm10). This mutation deletes 378 bp of ENSMUSE00000598905 (exon 1) resulting in a change of amino acid sequence after residue 7, a loss of 126 amino acids and remains in frame. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Grxcr1 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory