Slc6a7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc6a7^em1(IMPC)J
• Name: solute carrier family 6 (neurotransmitter transporter, L-proline), member 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342437
• Gene: Slc6a7 Location: Chr18:61128452-61147294 bp, - strand Genetic Position: Chr18, 34.41 cM, cytoband E1
• Alliance: Slc6a7^em1(IMPC)J page
• IMPC: Slc6a7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTTCCTAGAACCTATAGT and TGGCTAGCAGAAATAGGCCA, which resulted in a 636 bp deletion beginning at Chromosome 18 position 61,009,209 bp and ending after 61,009,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000143841 (exon 2) and 452 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 53 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc6a7 Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)