Krt32^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt32^{em1(IMPC)Kmpc}
• Name: keratin 32; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:6341960
• Gene: Krt32 Location: Chr11:99971674-99979095 bp, - strand Genetic Position: Chr11, 63.4 cM
• Alliance: Krt32^{em1(IMPC)Kmpc} page
• IMPC: Krt32 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and 2 guide sequences CCCATGTTACTGGAACAGACGGA, CCTGTAGGTGGTCGGCATGCAGA, which resulted in a Indel. (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Krt32 Mutation: 22 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)