Sack1d^{em1(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sack1d^{em1(IMPC)Ccpcz}
• Name: scaffolding CK1 anchoring protein D; endonuclease-mediated mutation 1, Institute of Molecular Genetics
• MGI ID: MGI:6341891
• Gene: Sack1d Location: Chr2:158610013-158628557 bp, + strand Genetic Position: Chr2, 78.73 cM
• Alliance: Sack1d^{em1(IMPC)Ccpcz} page
• IMPC: Sack1d gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Czech Centre for Phenogenomics using Cas9 and guides with spacer sequences AACAGCTGGCACGATAGCAA and TGTGTGCTGTCACTAAATGG that targeted exon(s) ENSMUSE00000171511.2. This resulted in deletion(s) of 958 bp (location: Chr2:158624914-158625871; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Sack1d Mutation: 21 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)