About   Help   FAQ
Apbb1ipem1(IMPC)Ccpcz
Endonuclease-mediated Allele Detail
Summary
Symbol: Apbb1ipem1(IMPC)Ccpcz
Name: amyloid beta precursor protein binding family B member 1 interacting protein; endonuclease-mediated mutation 1, Institute of Molecular Genetics
MGI ID: MGI:6341869
Gene: Apbb1ip  Location: Chr2:22664106-22765665 bp, + strand  Genetic Position: Chr2, 15.15 cM, cytoband A3
Alliance: Apbb1ipem1(IMPC)Ccpcz page
IMPC: Apbb1ip gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences GCCTAGACAGGCTCTTTTGGGGG, CCTGGACGGTGCATTGTCCTTTA, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Apbb1ip Mutation:  43 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory