Fbxw16em1(IMPC)Ccpcz
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Fbxw16em1(IMPC)Ccpcz |
| Name: |
F-box and WD-40 domain protein 16; endonuclease-mediated mutation 1, Institute of Molecular Genetics |
| MGI ID: |
MGI:6341868 |
| Gene: |
Fbxw16 Location: Chr9:109261386-109278208 bp, - strand Genetic Position: Chr9, 59.66 cM
|
| Alliance: |
Fbxw16em1(IMPC)Ccpcz page
|
| IMPC: |
Fbxw16 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Czech Centre for Phenogenomics using Cas9 and guides with spacer sequences GAGTTGTACCAGTCTCATGA and GGAAGGTTAGGCGTACTCCT that targeted exon(s) ENSMUSE00001041703.2 ENSMUSE00000496053.5 ENSMUSE00000967235.2 ENSMUSE00000998269.2 ENSMUSE00001018332.2 ENSMUSE00001022244.2 ENSMUSE00001036445.2 ENSMUSE00001038867.2 ENSMUSE00001046697.2 ENSMUSE00001077603.2 ENSMUSE00001087906.2 ENSMUSE00001093217.2 ENSMUSE00001346484.2 ENSMUSE00001348234.2 ENSMUSE00001350344.2 ENSMUSE00001350402.2 ENSMUSE00001350684.2 ENSMUSE00001352637.2 ENSMUSE00001353805.2 ENSMUSE00001354372.2 ENSMUSE00001355073.2 ENSMUSE00001356129.2 ENSMUSE00001356397.2 ENSMUSE00001357266.2 ENSMUSE00001357297.2 ENSMUSE00001675726.1 ENSMUSE00001675728.1 ENSMUSE00001675730.1 ENSMUSE00001675731.1 ENSMUSE00001675733.1 ENSMUSE00002202471.1. This resulted in deletion(s) of 1167 bp (location: Chr9:109275143-109276309; GRCm39), 85891 bp (location: Chr9:109276485-109362375; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|