About   Help   FAQ
Golga7bem1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Golga7bem1(IMPC)Mbp
Name: golgin A7B; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6341839
Gene: Golga7b  Location: Chr19:42236017-42258787 bp, + strand  Genetic Position: Chr19, 36.01 cM, cytoband D1
Alliance: Golga7bem1(IMPC)Mbp page
IMPC: Golga7b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences AGGTGTACAGCCGGAGCGAGGGG, AAGCGCTTCGCTGGCCACCAAGG, which resulted in a Whole-gene deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Golga7b Mutation:  15 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory