Golga7b^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Golga7b^em1(IMPC)Mbp
• Name: golgin A7B; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6341839
• Gene: Golga7b Location: Chr19:42236017-42258787 bp, + strand Genetic Position: Chr19, 36.01 cM, cytoband D1
• Alliance: Golga7b^em1(IMPC)Mbp page
• IMPC: Golga7b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AAGCGCTTCGCTGGCCACCA and AGGTGTACAGCCGGAGCGAG that targeted exon(s) ENSMUSE00000641500.2 ENSMUSE00000641501.2 ENSMUSE00000641502.2 ENSMUSE00000712254.2 ENSMUSE00001464009.2. This resulted in deletion(s) of 5227 bp (location: Chr19:42251716-42256942; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Golga7b Mutation: 15 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)