About   Help   FAQ
Lhx5em1(IMPC)Ccpcz
Endonuclease-mediated Allele Detail
Summary
Symbol: Lhx5em1(IMPC)Ccpcz
Name: LIM homeobox protein 5; endonuclease-mediated mutation 1, Institute of Molecular Genetics
MGI ID: MGI:6341831
Gene: Lhx5  Location: Chr5:120569764-120579288 bp, + strand  Genetic Position: Chr5, 60.62 cM
Alliance: Lhx5em1(IMPC)Ccpcz page
IMPC: Lhx5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details:  This allele was generated at Czech Centre for Phenogenomics using Cas9 and guides with spacer sequences ACCCGAGCCAGGCTCGTCTT and AGACACCCGTATTTGTCCAA that targeted exon(s) ENSMUSE00000190535.4. This resulted in deletion(s) of 542 bp (location: Chr5:120572437-120572978; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Lhx5 Mutation:  19 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory