Park7^em2(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Park7^em2(IMPC)H
• Name: Parkinson disease (autosomal recessive, early onset) 7; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6336218
• Gene: Park7 Location: Chr4:150981590-150994378 bp, - strand Genetic Position: Chr4, 81.52 cM, cytoband E1
• Alliance: Park7^em2(IMPC)H page
• IMPC: Park7 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences CATCACGGCTACACTGCACG, CTGGACAAATCATTACATCA, GATGTGGTGGTTCTTCCAGG, and GGAAGAACCACCACATCGTA that targeted exon(s) ENSMUSE00001268977.2 ENSMUSE00001373728.2. This resulted in deletion(s) of 1806 bp (location: Chr4:150989739-150991544; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Park7 Mutation: 56 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)