Pcdhgc3^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdhgc3^{em1(IMPC)Hmgu}
• Name: protocadherin gamma subfamily C, 3; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6336215
• Gene: Pcdhgc3 Location: Chr18:37939463-37974926 bp, + strand Genetic Position: Chr18, 19.67 cM
• Alliance: Pcdhgc3^{em1(IMPC)Hmgu} page
• IMPC: Pcdhgc3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences GATGGTGGAAGCCTCGGTTA, GTCGCTGCGGCGAGAGTCCG, TCGGCAGTCTGTCGGCCCGC, and TTGCACGCAGACGCGGTGCG that targeted exon(s) ENSMUSE00000485402.2 ENSMUSE00001338863.2. This resulted in deletion(s) of 10 bp (location: Chr18:37939674-37939683; GRCm39), 2012 bp (location: Chr18:37939777-37941788; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pcdhgc3 Mutation: 56 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)