Tmx3^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmx3^{em1(IMPC)Kmpc}
• Name: thioredoxin-related transmembrane protein 3; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:6336145
• Gene: Tmx3 Location: Chr18:90528336-90561391 bp, + strand Genetic Position: Chr18, 59.37 cM
• Alliance: Tmx3^{em1(IMPC)Kmpc} page
• IMPC: Tmx3 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and 2 guide sequences GACTTGGCATATAATTACCGAGG, CCGAGGACCACGGACTAAAGATG, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmx3 Mutation: 26 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)