About   Help   FAQ
Tiam2em1(IMPC)Kmpc
Endonuclease-mediated Allele Detail
Summary
Symbol: Tiam2em1(IMPC)Kmpc
Name: T cell lymphoma invasion and metastasis 2; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
MGI ID: MGI:6336140
Gene: Tiam2  Location: Chr17:3376675-3569672 bp, + strand  Genetic Position: Chr17, 1.99 cM, cytoband A1
Alliance: Tiam2em1(IMPC)Kmpc page
IMPC: Tiam2 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and the guide sequence TGCGAGAGCTCGAAATGAGCAGG, which resulted in a Indel. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tiam2 Mutation:  103 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory