Slc24a3^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc24a3^{em1(IMPC)Kmpc}
• Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:6336134
• Gene: Slc24a3 Location: Chr2:145009695-145484086 bp, + strand Genetic Position: Chr2, 71.08 cM, cytoband H1
• Alliance: Slc24a3^{em1(IMPC)Kmpc} page
• IMPC: Slc24a3 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 RNA and 2 guide sequences CCCTGACTCTTAATGCTTTCTCC, ATTCCCAGTGTGCCTGAGAGAGG, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc24a3 Mutation: 27 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)