Rarbem1(IMPC)Kmpc
Endonuclease-mediated Allele Detail
|
Symbol: |
Rarbem1(IMPC)Kmpc |
Name: |
retinoic acid receptor, beta; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center |
MGI ID: |
MGI:6336132 |
Gene: |
Rarb Location: Chr14:5650540-6038924 bp, + strand Genetic Position: Chr14, 7.08 cM, cytoband A1-A3
|
Alliance: |
Rarbem1(IMPC)Kmpc page
|
IMPC: |
Rarb gene page |
|
Strain of Origin: |
C57BL/6N
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and 2 guide sequences GGCTACAATAGAGAAGAGAGGGG, CCGTCACAAGATTCTTAACAGGA, which resulted in a Exon Deletion.
(J:237616)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Rarb Mutation: |
39 strains or lines available
|
|
Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
All: |
1 reference(s) |
|