Mrps30^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrps30^{em1(IMPC)Kmpc}
• Name: mitochondrial ribosomal protein S30; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:6336124
• Gene: Mrps30 Location: Chr13:118516646-118523788 bp, - strand Genetic Position: Chr13, 66.88 cM
• Alliance: Mrps30^{em1(IMPC)Kmpc} page
• IMPC: Mrps30 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and a guide with spacer sequence CTGGTTGCGTGGTGAAGAAC that targeted exon(s) ENSMUSE00000474281.3. This resulted in deletion(s) of 2 bp (location: Chr13:118521870-118521871; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mrps30 Mutation: 19 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)