Ecm2^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ecm2^{em1(IMPC)Kmpc}
• Name: extracellular matrix protein 2, female organ and adipocyte specific; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:6336116
• Gene: Ecm2 Location: Chr13:49658286-49686265 bp, + strand Genetic Position: Chr13, 25.29 cM, cytoband B1
• Alliance: Ecm2^{em1(IMPC)Kmpc} page
• IMPC: Ecm2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and the guide sequence CCTCCTTCTGGGATCACTAGCCT, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ecm2 Mutation: 36 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)