Tex55^em2(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tex55^em2(IMPC)Ics
• Name: testis expressed 55; endonuclease-mediated mutation 2, Mouse Clinical Institute
• MGI ID: MGI:6336107
• Gene: Tex55 Location: Chr16:38632568-38649111 bp, - strand Genetic Position: Chr16, 26.87 cM, cytoband B4
• Alliance: Tex55^em2(IMPC)Ics page
• IMPC: Tex55 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Institut Clinique de la Souris using Cas9 and guides with spacer sequences AATCCAGATGGCCCACCTAT, GGCAGGTTCAGGCAGCGTGG, GGTCAAAGGGATGTGCCGGG, and GGTGGCATGTGTTAGTTATA that targeted exon(s) ENSMUSE00000354274.5 ENSMUSE00001384720.2 ENSMUSE00001387489.2 ENSMUSE00001549011.1 ENSMUSE00001549016.1 ENSMUSE00001549030.1 ENSMUSE00001549032.1. This resulted in deletion(s) of 1413 bp (location: Chr16:38648084-38649496; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Mice Carrying this Mutation:

6 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tex55 Mutation: 19 strains or lines available

References

• Original: J:324144 Jamin SP, et al., Tex55 encodes a conserved putative A-kinase anchoring protein dispensable for male fertility in the mouse. Biol Reprod. 2021 Apr 1;104(4):731-733
• All: 2 reference(s)