About   Help   FAQ
Tex55em2(IMPC)Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Tex55em2(IMPC)Ics
Name: testis expressed 55; endonuclease-mediated mutation 2, Mouse Clinical Institute
MGI ID: MGI:6336107
Gene: Tex55  Location: Chr16:38632568-38649111 bp, - strand  Genetic Position: Chr16, 26.87 cM, cytoband B4
Alliance: Tex55em2(IMPC)Ics page
IMPC: Tex55 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Institut Clinique de la Souris using Cas9 and guides with spacer sequences AATCCAGATGGCCCACCTAT, GGCAGGTTCAGGCAGCGTGG, GGTCAAAGGGATGTGCCGGG, and GGTGGCATGTGTTAGTTATA that targeted exon(s) ENSMUSE00000354274.5 ENSMUSE00001384720.2 ENSMUSE00001387489.2 ENSMUSE00001549011.1 ENSMUSE00001549016.1 ENSMUSE00001549030.1 ENSMUSE00001549032.1. This resulted in deletion(s) of 1413 bp (location: Chr16:38648084-38649496; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 6 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tex55 Mutation:  19 strains or lines available
References
Original:  J:324144 Jamin SP, et al., Tex55 encodes a conserved putative A-kinase anchoring protein dispensable for male fertility in the mouse. Biol Reprod. 2021 Apr 1;104(4):731-733
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory