Sh2b1^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sh2b1^em1(IMPC)Ics
• Name: SH2B adaptor protein 1; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:6336093
• Gene: Sh2b1 Location: Chr7:126066166-126074596 bp, - strand Genetic Position: Chr7, 69.06 cM
• Alliance: Sh2b1^em1(IMPC)Ics page
• IMPC: Sh2b1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Institut Clinique de la Souris using Cas9 and guides with spacer sequences CAATAACCCTCATATACCCC, GGTCATAGGTAGAGCAGCTA, GTCGAGCCCGTGTGAGCTGC, and GTTATATCTCAGCCCAGGCC that targeted exon(s) ENSMUSE00000202469.2 ENSMUSE00000202479.2 ENSMUSE00000202485.2 ENSMUSE00000435925.2. This resulted in deletion(s) of 2094 bp (location: Chr7:126070245-126072338; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sh2b1 Mutation: 51 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)