Adgrg4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adgrg4^em1(IMPC)J
• Name: adhesion G protein-coupled receptor G4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6330722
• Gene: Adgrg4 Location: ChrX:55939594-56025719 bp, + strand Genetic Position: ChrX, 30.34 cM
• Alliance: Adgrg4^em1(IMPC)J page
• IMPC: Adgrg4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAACTTCTTCCCAAACTAC and CCAACTGCCAAAGAGTCTAC, which resulted in a 5813 bp deletion beginning at Chromosome X position 56,913,220 bp and ending after 56,919,032 bp (GRCm38/mm10). This mutation deletes 5813 bp of ENSMUSE00000386381 (exon 3) and is predicted to cause a change of amino acid sequence after residue 254 and early truncation 9 amino acids later. There is a 1 bp insertion (G) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Adgrg4 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)