About   Help   FAQ
Rab33bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab33bem1(IMPC)J
Name: RAB33B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6324683
Gene: Rab33b  Location: Chr3:51391387-51403649 bp, + strand  Genetic Position: Chr3, 22.49 cM, cytoband D
Alliance: Rab33bem1(IMPC)J page
IMPC: Rab33b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGTGTCCCACAACTGGATC and CAGCACCAGCAAGTCACCGC, which resulted in a 428 bp deletion beginning at Chromosome 3 position 51,493,354 bp and ending after 51,493,781 bp (GRCm38/mm10). This mutation deletes 426 bp of the coding sequence (leaving the last 15 bases) of ENSMUSE00000387710 (exon 2) including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 54 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rab33b Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory