Zbtb37^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zbtb37^em1(IMPC)J
• Name: zinc finger and BTB domain containing 37; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324240
• Gene: Zbtb37 Location: Chr1:160830492-160862419 bp, - strand Genetic Position: Chr1, 69.75 cM
• Alliance: Zbtb37^em1(IMPC)J page
• IMPC: Zbtb37 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTAGGATCAGTAATTGCCA and AGTTCAAACATCCCTACAAA, which resulted in a 1328 bp deletion beginning at Chromosome 1 position 161,031,517 bp and ending after 161,032,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000947438 (exon 3) and 368 bp of flanking intronic sequence including the splice acceptor and donor and start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zbtb37 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)