Taf5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Taf5^em1(IMPC)J
• Name: TATA-box binding protein associated factor 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324237
• Synonyms: Taf5^-
• Gene: Taf5 Location: Chr19:47056187-47071918 bp, + strand Genetic Position: Chr19, 39.19 cM
• Alliance: Taf5^em1(IMPC)J page
• IMPC: Taf5 gene page

Taf5^em1(IMPC)J/Taf5^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida but form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AATAACCCTGACTAGGCTGT and GCAGTACTGGATTCCTCCCA that targeted exon(s) ENSMUSE00000375459.3. This resulted in deletion(s) of 2 bp (location: Chr19:47063824-47063825; GRCm39), 583 bp (location: Chr19:47063097-47063679; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	41 assay results 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Taf5 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)