Tbc1d32^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbc1d32^em1(IMPC)J
• Name: TBC1 domain family, member 32; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324235
• Gene: Tbc1d32 Location: Chr10:55890389-56104785 bp, - strand Genetic Position: Chr10, 28.45 cM
• Alliance: Tbc1d32^em1(IMPC)J page
• IMPC: Tbc1d32 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAACAGTAGTCTTGAGCGA and GATACACTACGCAGAAACCA, which resulted in a 557 bp deletion beginning at Chromosome 10 position 56,196,322 bp and ending after 56,196,878 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000502099 through ENSMUSE00000894977 (exons 6 through 8) and 312 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 227 and early truncation 37 amino acids later. There is a 1 bp (T) insertion and a 9 bp deletion (ACGCAGAAA) 84 bp after the deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tbc1d32 Mutation: 58 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)