About   Help   FAQ
Tbc1d32em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tbc1d32em1(IMPC)J
Name: TBC1 domain family, member 32; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6324235
Gene: Tbc1d32  Location: Chr10:55890389-56104785 bp, - strand  Genetic Position: Chr10, 28.45 cM
Alliance: Tbc1d32em1(IMPC)J page
IMPC: Tbc1d32 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAACAGTAGTCTTGAGCGA and GATACACTACGCAGAAACCA, which resulted in a 557 bp deletion beginning at Chromosome 10 position 56,196,322 bp and ending after 56,196,878 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000502099 through ENSMUSE00000894977 (exons 6 through 8) and 312 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 227 and early truncation 37 amino acids later. There is a 1 bp (T) insertion and a 9 bp deletion (ACGCAGAAA) 84 bp after the deletion. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tbc1d32 Mutation:  60 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory