Nacc1^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nacc1^{em1(IMPC)Hmgu}
• Name: nucleus accumbens associated 1, BEN and BTB (POZ) domain containing; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6324156
• Gene: Nacc1 Location: Chr8:85397106-85414528 bp, - strand Genetic Position: Chr8, 41.02 cM
• Alliance: Nacc1^{em1(IMPC)Hmgu} page
• IMPC: Nacc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Not Specified
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences ATGTACAGTATGTTGAACGT and CAACAACGGCAGCCGCAAGA that targeted exon(s) ENSMUSE00000333458.5 ENSMUSE00001660409.1. This resulted in deletion(s) of 293 bp (location: Chr8:85402983-85403275; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nacc1 Mutation: 68 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)